Probing DNA Duplex Formation and DNA-Drug Interactions by the Quartz Crystal Microbalance Technique

The detection of duplex formation for tethered films of 12-mer (d(CGCAAAAAAGCG)) and 34-mer ((d(GCGTTCATTGTGGTGATATGTGCGCAAAAAAGCG)) oligonucleotides and of subsequent small molecule (nogalamycin and berenil) binding is demonstrated using the quartz crystal microbalance (QCM) technique. The mass change sensitivity of the QCM technique is exploited to identify the binding of approximately two nogalamycin molecules per 12-mer duplex and seven nogalamycin molecules per 34- mer duplex. These data are consistent with previous reports of steric hindrance between nogalamycin molecules blocking simultaneous binding to closely spaced 5TpG and 5CpGsites. Noconsistent or significant shifts in frequency or dissipation were observed on exposure of the 12-mer or 34-mer films to berenil. This observation suggests that berenil binding has the net result of displacing a mass equivalent of 12-20 water molecules. The effect of packing within the 12-mer duplex films has been investigated, revealing interduplex separations at different surface concentrations of DNA and a minimum interduplex distance of 2.6 nm. The films formed from the 34-mer are demonstrated to increase energy dissipation in the oscillated film compared to that for the 12-mer, and this is proposed to result from increased duplex length and possibly interduplex entanglement. This conclusion is supported by a rise in dissipation observed as the 34-mer duplex length increases due to nogalamycin intercalation.